Overview of repeats

In a study by Favaro and colleagues (Favaro et al., 2014) 21 individuals with Richieri-Costa-Pereira syndrome were identified to have bi-allelic expansions of tandem repeats in the EIF4A3 gene. They described the following motifs:

• (A) 20 bp motif: TCGGCAGCGGCACAGCGAGG
• (B) 18 bp motif: TCGGCAGCGGCAGCGAGG
• (C) 20 bp motif: TCGGCAGCGGCGCAGCGAGG, that has G instead of an A

In healthy (control) individuals, the most common allelic pattern (97%) consisted of an initial (A)-20bp motif repeated 2 to 9 times, followed by one (B)-18bp, another (A)-20bp and one final (B)-18bp, totalling 5 to 12 repeats.
In contrast, affected individuals exhibited a different pattern: an initial (A)-20bp motif, followed by 12 to 13 repeats of (C)-20bp, one (A)-20bp and one final (B)-18bp, making a total of 15 or 16 repeats. The alleles in affected individuals are defined by the absolute number of repeats, which were either 15 or 16, in contrast to the 3 to 12 repeat range observed in controls.
The authors speculate that (C)-20bp motif is causing the instability of the region. As a note, one unaffected individual had also (C)-20bp present in the following pattern: an initial (A)-20bp motif, followed by 9 repeats of (C)-20bp and one (A)-20bp.
NB! The (A)-20bp is provided here as the motif but the coordinates are for the whole complex, including (B)-18bp.

→ View STRipy's population-wide repeat data for EIF4A3 locus